Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pFETCH_ATF1
(Plasmid #64689)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 64689 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFETCH_Donor
  • Backbone size w/o insert (bp) 5771
  • Total vector size (bp) 7200
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ATF1 Homology Arms
  • Alt name
    ATF1
  • Alt name
    TREB-36
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1600
  • Tag / Fusion Protein
    • 3X Flag P2A Neo (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer acgcctgtgaaaccgtacta
  • 3′ sequencing primer aactgttgggaagggcgatc
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

This plasmid has been used along with PX548_ATF1_1 to add a FLAG tag to human ATF1 in HepG2 cells by the Mendenhall and Myers labs at HudsonAlpha Institute for Biotechnology/UAH Note: This plasmid is part of the Mendenhall and Meyers CRISPR-based Tagging system to add a tag (currently using FLAG) to endogenous proteins. Please see https://www.addgene.org/crispr/tagging/ for more details.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFETCH_ATF1 was a gift from Eric Mendenhall & Richard M. Myers (Addgene plasmid # 64689 ; http://n2t.net/addgene:64689 ; RRID:Addgene_64689)
  • For your References section:

    CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Savic D, Partridge EC, Newberry KM, Smith SB, Meadows SK, Roberts BS, Mackiewicz M, Mendenhall EM, Myers RM. Genome Res. 2015 Sep 9. 10.1101/gr.193540.115 PubMed 26355004