pET28b-His tagged nuclear Pif1
(Plasmid
#65047)
-
Purposeexpression of the nuclear form of Pif1p (Pif1p-delta40), Nterminal His tag
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 65047 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28b(+)
-
Backbone manufacturernovagen
- Backbone size w/o insert (bp) 5254
- Total vector size (bp) 7777
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameYeast Pif1, nuclear form, N-terminal 6x His-tag
-
Alt nameyPIF1delta40
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)2523
-
GenBank IDNM_001182420
-
Entrez GenePIF1 (a.k.a. YML061C, TST1)
- Promoter T7 promoter
-
Tag
/ Fusion Protein
- histag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28b-His tagged nuclear Pif1 was a gift from Jean-Baptiste Boulé & Virgina Zakian (Addgene plasmid # 65047 ; http://n2t.net/addgene:65047 ; RRID:Addgene_65047) -
For your References section:
The yeast Pif1p helicase removes telomerase from telomeric DNA. Boule JB, Vega LR, Zakian VA. Nature. 2005 Nov 3;438(7064):57-61. Epub 2005 Aug 24. 10.1038/nature04091 PubMed 16121131