pLVTH-shNP1
(Plasmid
#65062)
-
PurposeKnockdown of NP1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 65062 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLVTH
-
Backbone manufacturerDidier Trono
- Backbone size w/o insert (bp) 11090
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshNP1
-
gRNA/shRNA sequenceGATCCCCGTACAGCCGCCTCAATTCTTTCAAGAGAAGAATTGAGGCGGCTGTACTTTTT
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)59
-
Entrez GeneNptx1
- Promoter H1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer H1
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVTH-shNP1 was a gift from Ramon Trullas (Addgene plasmid # 65062 ; http://n2t.net/addgene:65062 ; RRID:Addgene_65062) -
For your References section:
Neuronal pentraxin 1 negatively regulates excitatory synapse density and synaptic plasticity. Figueiro-Silva J, Gruart A, Clayton KB, Podlesniy P, Abad MA, Gasull X, Delgado-Garcia JM, Trullas R. J Neurosci. 2015 Apr 8;35(14):5504-21. doi: 10.1523/JNEUROSCI.2548-14.2015. 10.1523/JNEUROSCI.2548-14.2015 PubMed 25855168