SLC30A10-delta105-107
(Plasmid
#65205)
-
PurposeConstitutive expression of SLC30A10 delta 105-107 in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 65205 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV-Flag-10
-
Backbone manufacturerSigma
- Backbone size w/o insert (bp) 6400
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSLC30A10
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1446
-
Mutationdelta 105-107 amino acids
-
Entrez GeneSLC30A10 (a.k.a. HMDPC, HMNDYT1, ZNT10, ZNT8, ZRC1, ZnT-10)
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CMV Forward
- 3′ sequencing primer C-CMV-24 (TATTAGGACAAGGCTGGTGGGCAC)
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySC30A10 WT received from Dr. Ruth Valentine
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Amino acids 105-107 were deleted by Quikchange.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SLC30A10-delta105-107 was a gift from Somshuvra Mukhopadhyay (Addgene plasmid # 65205 ; http://n2t.net/addgene:65205 ; RRID:Addgene_65205) -
For your References section:
SLC30A10 is a cell surface-localized manganese efflux transporter, and parkinsonism-causing mutations block its intracellular trafficking and efflux activity. Leyva-Illades D, Chen P, Zogzas CE, Hutchens S, Mercado JM, Swaim CD, Morrisett RA, Bowman AB, Aschner M, Mukhopadhyay S. J Neurosci. 2014 Oct 15;34(42):14079-95. doi: 10.1523/JNEUROSCI.2329-14.2014. 10.1523/JNEUROSCI.2329-14.2014 PubMed 25319704