pDCAF3-IS5
(Plasmid #65220)

• Purpose: Expresses N-demethylases for the degredation of caffeine and related methylxanthines. Can be used to measure caffeine content as described in the publication listed below.
• Depositing Lab: Jeffrey Barrick
• Publication: Quandt et al ACS Synth Biol. 2013 Jun 21;2(6):301-7. doi: 10.1021/sb4000146. Epub 2013 Mar 22.

Backbone

• Vector backbone: pSB1C3
• Backbone manufacturer: igem parts registry
• Backbone size w/o insert (bp): 2070
• Total vector size (bp): 8920
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Kanamycin, 25 & 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): BW25113 ΔguaB::kanR
• Growth instructions: Grow in minimal medium supplemented with 200 uM caffeine, 34 ug/mL chloramphenicol, and 50 ug/mL kanamycin. M9 minimal medium supplemented with 2 g/L glucose and 2 g/L casein (M9GC) is recommended. Plasmid carries chloramphenicol resistance. Strain is auxotrophic for guanine and has a kanamycin resistance marker integrated into the chromosome. Supplementation with caffeine rescues this auxotrophy through the activity of the demethylation enzymes encoded on the plasmid
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: ndmA
• Alt name: Methylxanthine N1-demethylase
• Species: Pseudomonas putida strain CBB5
• Insert Size (bp): 1056
• GenBank ID: JQ061127.1 KC619530.1
• Promoter: BBa_J23100

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tgccacctgacgtctaagaa
• 3′ sequencing primer: attaccgcctttgagtgagc

Gene/Insert 2

• Gene/Insert name: ndmB
• Alt name: Methylxanthine N3-demethylase
• Species: Pseudomonas putida strain CBB5
• Insert Size (bp): 1068
• Mutation: Changed start codon from gtg to atg
• GenBank ID: JQ061128.1 KC619530.1
• Promoter: BBa_J23100

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tgccacctgacgtctaagaa
• 3′ sequencing primer: attaccgcctttgagtgagc

Gene/Insert 3

• Gene/Insert name: ndmC
• Alt name: Methylxanthine N7-demethylase
• Species: Pseudomonas putida strain CBB5
• Insert Size (bp): 855
• GenBank ID: JQ061129.1 KC619530.1
• Promoter: BBa_J23100

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tgccacctgacgtctaagaa
• 3′ sequencing primer: attaccgcctttgagtgagc

Gene/Insert 4

• Gene/Insert name: ndmD
• Alt name: Methylxanthine N-demethylase electron transfer protein
• Species: Pseudomonas putida strain CBB5
• Insert Size (bp): 1767
• Mutation: Changed start codon from gtg to atg.
• GenBank ID: JQ061130.1 KC619530.1
• Promoter: BBa_J23100

Cloning Information for Gene/Insert 4

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tgccacctgacgtctaagaa
• 3′ sequencing primer: attaccgcctttgagtgagc

Gene/Insert 5

• Gene/Insert name: gst9
• Alt name: Glutathione S-Transferase.
• Alt name: Homolog of the ndmE gene from pseudomonas putida CBB5.
• Species: Janthinobacterium sp. Marseille
• Insert Size (bp): 675
• GenBank ID: WP_012081511.1 KC619530.1
• Promoter: BBa_J23100

Cloning Information for Gene/Insert 5

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tgccacctgacgtctaagaa
• 3′ sequencing primer: attaccgcctttgagtgagc

Gene/Insert 6

• Gene/Insert name: chlR
• Alt name: CAT. Chloramphenicol acetyltransferase.
• Insert Size (bp): 660
• GenBank ID: KC619530.1

Resource Information

• Supplemental Documents:
  • Annotated GenBank file
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA

Depositor Comments

The sequence of this plasmid is updated from the GenBank entry for pDCAF3 (KC619530.1) to include an IS5 insertion that occurred in the promoter region of the caffeine demethylation genes during passaging of the strain and a base change in the sequence of the gst9 gene. This plasmid still functions as described in the publication for pDCAF3.

Vector constitutively expresses N-demethylase genes under the control of the BBa_J23100 promoter (http://parts.igem.org/Part:BBa_J23100).

N-demethylases are only functional when grown at 30°C and require iron supplementation in minimal media. See:
Summers, R. M., Louie, T. M., Yu, C.-L., Gakhar, L., Louie, K.C., and Subramanian, M. (2012) Novel, highly specific Ndemethylases enable bacteria to live on caffeine and related purine alkaloids. J. Bacteriol. 194, 2041−2049.

For the quantification of caffeine (or other methylxanthine) content it is recommended to grow cells in M9 minimal medium supplemented with 2 g/L glucose and 2 g/L casein (M9GC).

Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at or contact our distributors if you have any questions.