Skip to main content

pDCAF3-IS5
(Plasmid #65220)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 65220 Standard format: Plasmid sent in bacteria as agar stab 1 $94 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pSB1C3
  • Backbone manufacturer
    igem parts registry
  • Backbone size w/o insert (bp) 2070
  • Total vector size (bp) 8920
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Kanamycin, 25 & 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    BW25113 ΔguaB::kanR
  • Growth instructions
    Grow in minimal medium supplemented with 200 uM caffeine, 34 ug/mL chloramphenicol, and 50 ug/mL kanamycin. M9 minimal medium supplemented with 2 g/L glucose and 2 g/L casein (M9GC) is recommended. Plasmid carries chloramphenicol resistance. Strain is auxotrophic for guanine and has a kanamycin resistance marker integrated into the chromosome. Supplementation with caffeine rescues this auxotrophy through the activity of the demethylation enzymes encoded on the plasmid
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    ndmA
  • Alt name
    Methylxanthine N1-demethylase
  • Species
    Pseudomonas putida strain CBB5
  • Insert Size (bp)
    1056
  • GenBank ID
    JQ061127.1 KC619530.1
  • Promoter BBa_J23100

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tgccacctgacgtctaagaa
  • 3′ sequencing primer attaccgcctttgagtgagc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    ndmB
  • Alt name
    Methylxanthine N3-demethylase
  • Species
    Pseudomonas putida strain CBB5
  • Insert Size (bp)
    1068
  • Mutation
    Changed start codon from gtg to atg
  • GenBank ID
    JQ061128.1 KC619530.1
  • Promoter BBa_J23100

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tgccacctgacgtctaagaa
  • 3′ sequencing primer attaccgcctttgagtgagc
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    ndmC
  • Alt name
    Methylxanthine N7-demethylase
  • Species
    Pseudomonas putida strain CBB5
  • Insert Size (bp)
    855
  • GenBank ID
    JQ061129.1 KC619530.1
  • Promoter BBa_J23100

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tgccacctgacgtctaagaa
  • 3′ sequencing primer attaccgcctttgagtgagc
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    ndmD
  • Alt name
    Methylxanthine N-demethylase electron transfer protein
  • Species
    Pseudomonas putida strain CBB5
  • Insert Size (bp)
    1767
  • Mutation
    Changed start codon from gtg to atg.
  • GenBank ID
    JQ061130.1 KC619530.1
  • Promoter BBa_J23100

Cloning Information for Gene/Insert 4

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tgccacctgacgtctaagaa
  • 3′ sequencing primer attaccgcctttgagtgagc
  • (Common Sequencing Primers)

Gene/Insert 5

  • Gene/Insert name
    gst9
  • Alt name
    Glutathione S-Transferase.
  • Alt name
    Homolog of the ndmE gene from pseudomonas putida CBB5.
  • Species
    Janthinobacterium sp. Marseille
  • Insert Size (bp)
    675
  • GenBank ID
    WP_012081511.1 KC619530.1
  • Promoter BBa_J23100

Cloning Information for Gene/Insert 5

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tgccacctgacgtctaagaa
  • 3′ sequencing primer attaccgcctttgagtgagc
  • (Common Sequencing Primers)

Gene/Insert 6

  • Gene/Insert name
    chlR
  • Alt name
    CAT. Chloramphenicol acetyltransferase.
  • Insert Size (bp)
    660
  • GenBank ID
    KC619530.1

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The sequence of this plasmid is updated from the GenBank entry for pDCAF3 (KC619530.1) to include an IS5 insertion that occurred in the promoter region of the caffeine demethylation genes during passaging of the strain and a base change in the sequence of the gst9 gene. This plasmid still functions as described in the publication for pDCAF3.

Vector constitutively expresses N-demethylase genes under the control of the BBa_J23100 promoter (http://parts.igem.org/Part:BBa_J23100)

N-demethylases are only functional when grown at 30°C and require iron supplementation in minimal media. See:
Summers, R. M., Louie, T. M., Yu, C.-L., Gakhar, L., Louie, K.C., and Subramanian, M. (2012) Novel, highly specific Ndemethylases enable bacteria to live on caffeine and related purine alkaloids. J. Bacteriol. 194, 2041−2049.

For the quantification of caffeine (or other methylxanthine) content it is recommended to grow cells in M9 minimal medium supplemented with 2 g/L glucose and 2 g/L casein (M9GC).

Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDCAF3-IS5 was a gift from Jeffrey Barrick (Addgene plasmid # 65220 ; http://n2t.net/addgene:65220 ; RRID:Addgene_65220)
  • For your References section:

    Decaffeination and measurement of caffeine content by addicted Escherichia coli with a refactored N-demethylation operon from Pseudomonas putida CBB5. Quandt EM, Hammerling MJ, Summers RM, Otoupal PB, Slater B, Alnahhas RN, Dasgupta A, Bachman JL, Subramanian MV, Barrick JE. ACS Synth Biol. 2013 Jun 21;2(6):301-7. doi: 10.1021/sb4000146. Epub 2013 Mar 22. 10.1021/sb4000146 PubMed 23654268