Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLXSN-EGFR
(Plasmid #65226)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 65226 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLXSN
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 5900
  • Total vector size (bp) 9900
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    EGFR
  • Alt name
    HER1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4000
  • GenBank ID
    NM_005228
  • Entrez Gene
    EGFR (a.k.a. ERBB, ERBB1, ERRP, HER1, NISBD2, PIG61, mENA)
  • Promoter LTR

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HpaI (destroyed during cloning)
  • 3′ cloning site HpaI (destroyed during cloning)
  • 5′ sequencing primer CTCTCCCCCTTGAACCTC
  • 3′ sequencing primer GACTTTCCACACCCTAACTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLXSN-EGFR was a gift from Axel Ullrich (Addgene plasmid # 65226 ; http://n2t.net/addgene:65226 ; RRID:Addgene_65226)
  • For your References section:

    Transforming potentials of epidermal growth factor and nerve growth factor receptors inversely correlate with their phospholipase C gamma affinity and signal activation. Obermeier A, Tinhofer I, Grunicke HH, Ullrich A. EMBO J. 1996 Jan 2;15(1):73-82. PubMed 8598208