Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

shERK2a-mlpx-puro
(Plasmid #65229)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 65229 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMLPX
  • Backbone size w/o insert (bp) 6533
  • Total vector size (bp) 6617
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shRNA against ERK2
  • gRNA/shRNA sequence
    CCAGATCCTCAGAGGGTTAAA
  • Species
    H. sapiens (human)
  • Entrez Gene
    MAPK1 (a.k.a. ERK, ERK-2, ERK2, ERT1, MAPK2, NS13, P42MAPK, PRKM1, PRKM2, p38, p40, p41, p41mapk, p42-MAPK)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer cccttgaacctcctcGttcgac
  • 3′ sequencing primer CTTCGCGCCACCTTCTACTCCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    shERK2a-mlpx-puro was a gift from Gerardo Ferbeyre (Addgene plasmid # 65229 ; http://n2t.net/addgene:65229 ; RRID:Addgene_65229)
  • For your References section:

    Tumor suppressor activity of the ERK/MAPK pathway by promoting selective protein degradation. Deschenes-Simard X, Gaumont-Leclerc MF, Bourdeau V, Lessard F, Moiseeva O, Forest V, Igelmann S, Mallette FA, Saba-El-Leil MK, Meloche S, Saad F, Mes-Masson AM, Ferbeyre G. Genes Dev. 2013 Apr 15;27(8):900-15. doi: 10.1101/gad.203984.112. Epub 2013 Apr 18. 10.1101/gad.203984.112 PubMed 23599344