Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

GFP_CD47_SU
(Plasmid #65473)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 65473 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5372
  • Total vector size (bp) 7290
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Signal peptide of CD47
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    60
  • GenBank ID
    NM_001777.3

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer T7
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    GFP
  • GenBank ID

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BsrGI (not destroyed)
  • 5′ sequencing primer T7
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    CD47 coding region continued and short 3’UTR.
  • Insert Size (bp)
    1144
  • GenBank ID
    NM_001777.3

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsrGI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GGTGAACTTCAAGATCCGCC
  • 3′ sequencing primer BGH Rev
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP_CD47_SU was a gift from Christine Mayr (Addgene plasmid # 65473 ; http://n2t.net/addgene:65473 ; RRID:Addgene_65473)
  • For your References section:

    Alternative 3' UTRs act as scaffolds to regulate membrane protein localization. Berkovits BD, Mayr C. Nature. 2015 Apr 20. doi: 10.1038/nature14321. 10.1038/nature14321 PubMed 25896326