PAS515 (TJF082)
(Plasmid
#65582)
-
PurposepETDuet-1 Containing FadD F447R
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65582 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepETDuet-1
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5420
- Total vector size (bp) 7084
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Mach1
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFadD
-
SpeciesE. coli
-
Insert Size (bp)1686
-
MutationF447R
- Promoter T7 lacO
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer ctcgatcccgcgaaattaatacg
- 3′ sequencing primer CTTAAGCATTATGCGGCCGCAAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PAS515 (TJF082) was a gift from Pamela Silver (Addgene plasmid # 65582 ; http://n2t.net/addgene:65582 ; RRID:Addgene_65582) -
For your References section:
Enhancement of E. coli acyl-CoA synthetase FadD activity on medium chain fatty acids. Ford TJ, Way JC. PeerJ. 2015 Jun 30;3:e1040. doi: 10.7717/peerj.1040. eCollection 2015. 10.7717/peerj.1040 PubMed 26157619
Map uploaded by the depositor.