Skip to main content

pWY82
(Plasmid #65721)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 65721 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTF101.1
  • Backbone size w/o insert (bp) 9189
  • Total vector size (bp) 11656
  • Vector type
    Plant Expression
  • Selectable markers
    Basta

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin and Streptomycin, 50 & 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl2
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Telomere
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    2500

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI,EcoRI (not destroyed)
  • 3′ cloning site NcoI,EcoRV (not destroyed)
  • 5′ sequencing primer gggcgacgtcgactgttta
  • 3′ sequencing primer TCACACAGGAAACAGCTATGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene was unable to sequence this plasmid due to the repetitive nature of the telomere repeats. The plasmid was instead verified by restriction digest. The gel image is provided on this page under- Resource Information- Addgene Notes.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWY82 was a gift from James Birchler (Addgene plasmid # 65721 ; http://n2t.net/addgene:65721 ; RRID:Addgene_65721)
  • For your References section:

    Telomere-mediated chromosomal truncation in maize. Yu W, Lamb JC, Han F, Birchler JA. Proc Natl Acad Sci U S A. 2006 Nov 14;103(46):17331-6. Epub 2006 Nov 3. 10.1073/pnas.0605750103 PubMed 17085598