pWY82
(Plasmid
#65721)
-
PurposePlasmid with 2.5 kb of telomere sequence
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65721 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepTF101.1
- Backbone size w/o insert (bp) 9189
- Total vector size (bp) 11656
-
Vector typePlant Expression
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin and Streptomycin, 50 & 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl2
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTelomere
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)2500
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI,EcoRI (not destroyed)
- 3′ cloning site NcoI,EcoRV (not destroyed)
- 5′ sequencing primer gggcgacgtcgactgttta
- 3′ sequencing primer TCACACAGGAAACAGCTATGAC (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene was unable to sequence this plasmid due to the repetitive nature of the telomere repeats. The plasmid was instead verified by restriction digest. The gel image is provided on this page under- Resource Information- Addgene Notes.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWY82 was a gift from James Birchler (Addgene plasmid # 65721 ; http://n2t.net/addgene:65721 ; RRID:Addgene_65721) -
For your References section:
Telomere-mediated chromosomal truncation in maize. Yu W, Lamb JC, Han F, Birchler JA. Proc Natl Acad Sci U S A. 2006 Nov 14;103(46):17331-6. Epub 2006 Nov 3. 10.1073/pnas.0605750103 PubMed 17085598