Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pENTRY4_HuD
(Plasmid #65754)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 65754 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pENTR 4
  • Backbone manufacturer
    Life Technologies, Modified by Tuschl lab
  • Backbone size w/o insert (bp) 2279
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ELAVL4
  • Species
    H. sapiens (human)
  • Entrez Gene
    ELAVL4 (a.k.a. HUD, PNEM)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer pENTR-F - CTACAAACTCTTCCTGTTAGTTAG
  • 3′ sequencing primer pENTR4-R - attttgagacacgggccaga
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENTRY4_HuD was a gift from Thomas Tuschl (Addgene plasmid # 65754 ; http://n2t.net/addgene:65754 ; RRID:Addgene_65754)