pcDNA3.2-R5A-K6A C11orf83-V5
(Plasmid
#65850)
-
PurposeMammalian expression of C terminally V5-tagged C11orf83/UQCC3 : MUTANT R5A-K6A
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65850 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCDNA 3.2
-
Backbone manufacturerLife technologies
- Total vector size (bp) 5832
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMutated UQCC3
-
Alt nameC11orf83
-
SpeciesH. sapiens (human)
-
MutationR5A-K6A
-
GenBank IDNM_001085372.2
-
Entrez GeneUQCC3 (a.k.a. C11orf83, CCDS41658.1, MC3DN9, UNQ655)
-
Tag
/ Fusion Protein
- V5 (C terminal on insert)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer CACCATGGATTCCTTGCGGAAAATGCTGATCTC
- 3′ sequencing primer CGGTGACCTCCCGCCGGCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.2-R5A-K6A C11orf83-V5 was a gift from Amos Bairoch (Addgene plasmid # 65850 ; http://n2t.net/addgene:65850 ; RRID:Addgene_65850) -
For your References section:
C11orf83, a mitochondrial cardiolipin-binding protein involved in bc1 complex assembly and supercomplex stabilization. Desmurs M, Foti M, Raemy E, Vaz FM, Martinou JC, Bairoch A, Lane L. Mol Cell Biol. 2015 Apr;35(7):1139-56. doi: 10.1128/MCB.01047-14. Epub 2015 Jan 20. 10.1128/MCB.01047-14 PubMed 25605331