pBAV-A
(Plasmid
#65927)
-
PurposeTheophylline Riboswitch A with lacZ gene
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65927 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBAV1K
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Top10
-
Growth instructionsPlasmid also functions in bacterial species A. baylyi
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namelacZ
-
Alt namebeta-galactosidase
-
SpeciesSynthetic
-
Insert Size (bp)3200
- Promoter T5
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (unknown if destroyed)
- 3′ cloning site SpeI (unknown if destroyed)
- 5′ sequencing primer cgcggccgcttctagaggaaatc
- 3′ sequencing primer CGGCCTCCGCAGGAAGCCGTTTTTTTCG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byColleen Reynoso
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAV-A was a gift from Justin Gallivan (Addgene plasmid # 65927 ; http://n2t.net/addgene:65927 ; RRID:Addgene_65927) -
For your References section:
Synthetic riboswitches that induce gene expression in diverse bacterial species. Topp S, Reynoso CM, Seeliger JC, Goldlust IS, Desai SK, Murat D, Shen A, Puri AW, Komeili A, Bertozzi CR, Scott JR, Gallivan JP. Appl Environ Microbiol. 2010 Dec;76(23):7881-4. doi: 10.1128/AEM.01537-10. Epub 2010 Oct 8. 10.1128/AEM.01537-10 PubMed 20935124