Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #66533)


Item Catalog # Description Quantity Price (USD)
Plasmid 66533 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5155
  • Total vector size (bp) 5866
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Mutation
    Codon Optimized for E. coli
  • Promoter Mutant T7 Promoter - G6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer cgagatcgatctcgatcccg
  • 3′ sequencing primer GCT AGT TAT TGC TCA GCG G
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pETM6-G6-mCherry was a gift from Mattheos Koffas (Addgene plasmid # 66533 ; ; RRID:Addgene_66533)
  • For your References section:

    ePathOptimize: A Combinatorial Approach for Transcriptional Balancing of Metabolic Pathways. Jones JA, Vernacchio VR, Lachance DM, Lebovich M, Fu L, Shirke AN, Schultz VL, Cress B, Linhardt RJ, Koffas MA. Sci Rep. 2015 Jun 11;5:11301. doi: 10.1038/srep11301. 10.1038/srep11301 PubMed 26062452