-
Purposemammalian expression vector for MARK2 with a C-terminal eGFP
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 66706 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBa-eGFP
- Backbone size w/o insert (bp) 6732
- Total vector size (bp) 8967
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMARK2
-
Alt namemicrotubule affinity-regulating kinase 2
-
Alt nameMAP/microtubule affinity-regulating kinase 2
-
Alt nameSerine/threonine-protein kinase MARK2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2235
-
GenBank IDNM_004954 NP_004945.4
-
Entrez GeneMARK2 (a.k.a. EMK-1, EMK1, PAR-1, Par-1b, Par1b)
- Promoter chicken beta actin
-
Tag
/ Fusion Protein
- eGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BlnI-blunted on vector, PsiI on insert (destroyed during cloning)
- 3′ cloning site BlnI-blunted on vector, PsiI on insert (destroyed during cloning)
- 5′ sequencing primer TTCGGCTTCTGGCGTGTGAC
- 3′ sequencing primer AGCTTGCCGGTGGTGCAGAT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byFrom Addgene (Plasmid #23404 from William Hahn) which contained 2bp deletion causing a frame shift. This was repaired by PCR and Restriction sites: 5' ClaI and 3' Bsu36I. Both sites remain. Sequence of primer to verify repair 5'-AACCTCAAGGAGCTGCGGGAAC-3'
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination.
XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBa-MARK2-eGFP was a gift from Gary Banker & Marvin Bentley (Addgene plasmid # 66706 ; http://n2t.net/addgene:66706 ; RRID:Addgene_66706)