-
PurposeExpresses a murine/human chimeric IgG1 HPV16 L2-specific neutralizing antibody that recognizes HPV16 L2 amino acid region 58-64 . JWW-2 works in ELISA/WB/HPV
-
Depositing Lab
-
Sequence Information
-
Sequences (5) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 66749 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepVitro-neo-mcs
-
Backbone manufacturerinvivogen
- Backbone size w/o insert (bp) 6295
- Total vector size (bp) 8390
-
Modifications to backbonepVITRO1-MCS plasmids carry two elongation factor 1 alpha (EF-1α) promoters, from rat (rEF1) and mouse (mEF1) origins
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameJWW-2 Heavy Chain
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Insert Size (bp)1401
- Promoter mEF1
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (destroyed during cloning)
- 3′ cloning site NheI (destroyed during cloning)
- 5′ sequencing primer TTTTGAGCGGAGCTAATTCTCGGG
- 3′ sequencing primer AAAAAACCTCCCACACCTCC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameJWW-2 Light Chain
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Insert Size (bp)708
- Promoter rEF1
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site AvrII (destroyed during cloning)
- 5′ sequencing primer GAGGCTAATTCTCAAGCCTC
- 3′ sequencing primer TCTAGACCTGGAAAGACCAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
JWW-2 human chimeric monoclonal antibody was a gift from Richard Roden (Addgene plasmid # 66749 ; http://n2t.net/addgene:66749 ; RRID:Addgene_66749) -
For your References section:
Sero-epidemiology of HPV16 L2 and generation of papillomavirus L2-specific human chimeric monoclonal antibodies. Wang JW, Jagu S, Wu WH, Viscidi RP, Macgregor-Das A, Fogel JM, Kwak K, Daayana S, Kitchener H, Stern PL, Gravitt PE, Trimble CL, Roden RB. Clin Vaccine Immunol. 2015 May 13. pii: CVI.00799-14. 10.1128/CVI.00799-14 PubMed 25972404