Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

JWW-2 human chimeric monoclonal antibody
(Plasmid #66749)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 66749 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pVitro-neo-mcs
  • Backbone manufacturer
    invivogen
  • Backbone size w/o insert (bp) 6295
  • Total vector size (bp) 8390
  • Modifications to backbone
    pVITRO1-MCS plasmids carry two elongation factor 1 alpha (EF-1α) promoters, from rat (rEF1) and mouse (mEF1) origins
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    JWW-2 Heavy Chain
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Insert Size (bp)
    1401
  • Promoter mEF1

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (destroyed during cloning)
  • 3′ cloning site NheI (destroyed during cloning)
  • 5′ sequencing primer TTTTGAGCGGAGCTAATTCTCGGG
  • 3′ sequencing primer AAAAAACCTCCCACACCTCC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    JWW-2 Light Chain
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Insert Size (bp)
    708
  • Promoter rEF1

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site AvrII (destroyed during cloning)
  • 5′ sequencing primer GAGGCTAATTCTCAAGCCTC
  • 3′ sequencing primer TCTAGACCTGGAAAGACCAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    JWW-2 human chimeric monoclonal antibody was a gift from Richard Roden (Addgene plasmid # 66749 ; http://n2t.net/addgene:66749 ; RRID:Addgene_66749)
  • For your References section:

    Sero-epidemiology of HPV16 L2 and generation of papillomavirus L2-specific human chimeric monoclonal antibodies. Wang JW, Jagu S, Wu WH, Viscidi RP, Macgregor-Das A, Fogel JM, Kwak K, Daayana S, Kitchener H, Stern PL, Gravitt PE, Trimble CL, Roden RB. Clin Vaccine Immunol. 2015 May 13. pii: CVI.00799-14. 10.1128/CVI.00799-14 PubMed 25972404