Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMAL-c5X-AB12
(Plasmid #67005)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 67005 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMAL-c5X
  • Backbone manufacturer
    New England Biolabs
  • Backbone size w/o insert (bp) 5677
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    malE-AB12
  • Species
    Synthetic
  • Promoter tac
  • Tags / Fusion Proteins
    • malE-Factor Xa (N terminal on backbone)
    • His6 (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGTCGTCAGACTGTCGATGAAGCC
  • 3′ sequencing primer TGTCCTACTCAGGAGAGCGTTCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMAL-c5X-AB12 was a gift from Ashutosh Chilkoti (Addgene plasmid # 67005 ; http://n2t.net/addgene:67005 ; RRID:Addgene_67005)
  • For your References section:

    Combinatorial codon scrambling enables scalable gene synthesis and amplification of repetitive proteins. Tang NC, Chilkoti A. Nat Mater. 2016 Jan 4. doi: 10.1038/nmat4521. 10.1038/nmat4521 PubMed 26726995