pBS/U6/RNAi SadBs shRNA mouse
(Plasmid
#67152)
-
PurposepBS/U6 containing shRNA to mouse SADBs
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67152 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBS/U6
-
Backbone manufacturerGift from Y. Shi, Harvard Medical School
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBRSK1
-
gRNA/shRNA sequenceGGAGAAGCTGTCGGAATCGG
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1032
-
Entrez GeneBrsk1 (a.k.a. Gm1100, SAD-B, SADB)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ApaI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer M13R
- 3′ sequencing primer U6 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBS/U6/RNAi SadBs shRNA mouse was a gift from Maria Alvarado-Kristensson & Ana Carrera (Addgene plasmid # 67152 ; http://n2t.net/addgene:67152 ; RRID:Addgene_67152) -
For your References section:
SADB phosphorylation of gamma-tubulin regulates centrosome duplication. Alvarado-Kristensson M, Rodriguez MJ, Silio V, Valpuesta JM, Carrera AC. Nat Cell Biol. 2009 Sep;11(9):1081-92. doi: 10.1038/ncb1921. Epub 2009 Aug 2. 10.1038/ncb1921 PubMed 19648910