pCRISPaint-StrepTag II
(Plasmid
#67174)
-
PurposeCRISPaint universal donor for strep tag II fusion tagging
-
Depositing Lab
-
Depositing OrganizationUniversitaetsklinikum Bonn
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 67174 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 67174-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 67174-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCRISPaint
-
Backbone manufacturerVeit Hornung group
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameStrep Tag II
-
SpeciesSynthetic
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
please check ip situation
sequence with: TTCGCTATTACGCCAGCTGGCGA
DNA (Catalog # 67174-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 67174-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPaint-StrepTag II was a gift from Veit Hornung (Addgene plasmid # 67174 ; http://n2t.net/addgene:67174 ; RRID:Addgene_67174) -
For your References section:
CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Schmid-Burgk JL, Honing K, Ebert TS, Hornung V. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338. 10.1038/ncomms12338 PubMed 27465542