pUASt- Crb intraGFP
(Plasmid #67525)

• Purpose: Expression of transmembrane and the intracellular domains of Crb with GFP.
• Depositing Labs: Elisabeth Knust, Marta Llimargas Casanova
• Publication: Marta Llimargas Casanova plasmids (unpublished)

Backbone

• Vector backbone: pUAST
• Backbone size w/o insert (bp): 8904
• Vector type: Insect Expression ; Drosophila

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: crumbs
• Species: D. melanogaster (fly)
• Insert Size (bp): 1379
• Mutation: aa97-2103 deleted (extracellular domain)
• Entrez Gene: crb (a.k.a. Dmel_CG6383, 0509/20, 1384/04, CG6383, CRB, CT19912, Crb, Crbs, Crumbs, DmCrb, Dmel\CG6383, crumb, far, l(3)07207, l(3)S050920, l(3)S058104, l(3)j1B5)
• Promoter: hsp70
• Tag / Fusion Protein:
  • GFP

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: hsp70-F (GAGCGCCGGAGTATAAATAGAG)
• 3′ sequencing primer: SV40pA-R

Resource Information

• Supplemental Documents:
  • Cloning strategy
• A portion of this plasmid was derived from a plasmid made by: Untagged pUASt- Crb intra from Elisabeth Knust lab

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The plasmid contains part of the 5' cDNA of Crb and the 3' part that brings the transmembrane and the intracellular domains of the protein together. The BglII restriction site links the 5' and 3' regions of the cDNA, meaning that the majority of the extracellular part of the Crb protein is missing. The fragment also contains the 5' and 3' UTR regions. BglII restriction site was used to clone a GFP fragment. GFP is inserted between aa 96 and 2122 of crb. Crb contains K89E mutation which does not affect plasmid function.