Skip to main content

miR-141 reporter
(Plasmid #67632)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 67632 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    psiCHECK-2
  • Backbone size w/o insert (bp) 6273
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    2 binding sites for miR-141
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    63
  • Promoter SV40

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GCTGAAGAACGAGCAGTAAT
  • 3′ sequencing primer GTCAGACAAACCCTAACCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    miR-141 reporter was a gift from Judy Lieberman (Addgene plasmid # 67632 ; http://n2t.net/addgene:67632 ; RRID:Addgene_67632)
  • For your References section:

    miR-200-containing extracellular vesicles promote breast cancer cell metastasis. Le MT, Hamar P, Guo C, Basar E, Perdigao-Henriques R, Balaj L, Lieberman J. J Clin Invest. 2014 Dec;124(12):5109-28. doi: 10.1172/JCI75695. Epub 2014 Nov 17. 10.1172/JCI75695 PubMed 25401471