Skip to main content

AAV-CMV-Flag-PGC1a-6His
(Plasmid #67637)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 67637 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    AAV-GFP
  • Backbone manufacturer
    Jeng-Shin Lee, Harvard University
  • Total vector size (bp) 8617
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    PGC1a
  • Alt name
    Ppargc1a, peroxisome proliferative activated receptor, gamma, coactivator 1 alpha
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2448
  • Entrez Gene
    Ppargc1a (a.k.a. A830037N07Rik, Gm11133, PGC-1, PPARGC-1-alpha, Pgc-1alpha, Pgc1, Pgco1, Ppargc1)
  • Promoter CMV
  • Tags / Fusion Proteins
    • Flag tag (N terminal on insert)
    • 6XHis (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (not destroyed)
  • 3′ cloning site Xho1 (not destroyed)
  • 5′ sequencing primer tattggctcatgtccaacat
  • 3′ sequencing primer ataagacaacagagacaact
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Flag-PGC1a-6His sequence was obtained from Bruce Spiegelman Lab. Note that there is a Q339K mutation relative to the canonical GenBank sequence. This mutation has not been reported to affect function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-CMV-Flag-PGC1a-6His was a gift from Connie Cepko (Addgene plasmid # 67637 ; http://n2t.net/addgene:67637 ; RRID:Addgene_67637)
  • For your References section:

    NRF2 promotes neuronal survival in neurodegeneration and acute nerve damage. Xiong W, MacColl Garfinkel AE, Li Y, Benowitz LI, Cepko CL. J Clin Invest. 2015 Apr;125(4):1433-45. doi: 10.1172/JCI79735. Epub 2015 Mar 23. 10.1172/JCI79735 PubMed 25798616