-
PurposeAAV vector expressing PGC1a gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 67637 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAAV-GFP
-
Backbone manufacturerJeng-Shin Lee, Harvard University
- Total vector size (bp) 8617
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePGC1a
-
Alt namePpargc1a, peroxisome proliferative activated receptor, gamma, coactivator 1 alpha
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2448
-
Entrez GenePpargc1a (a.k.a. A830037N07Rik, Gm11133, PGC-1, PPARGC-1-alpha, Pgc-1alpha, Pgc1, Pgco1, Ppargc1)
- Promoter CMV
-
Tags
/ Fusion Proteins
- Flag tag (N terminal on insert)
- 6XHis (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (not destroyed)
- 3′ cloning site Xho1 (not destroyed)
- 5′ sequencing primer tattggctcatgtccaacat
- 3′ sequencing primer ataagacaacagagacaact
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Flag-PGC1a-6His sequence was obtained from Bruce Spiegelman Lab. Note that there is a Q339K mutation relative to the canonical GenBank sequence. This mutation has not been reported to affect function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-CMV-Flag-PGC1a-6His was a gift from Connie Cepko (Addgene plasmid # 67637 ; http://n2t.net/addgene:67637 ; RRID:Addgene_67637) -
For your References section:
NRF2 promotes neuronal survival in neurodegeneration and acute nerve damage. Xiong W, MacColl Garfinkel AE, Li Y, Benowitz LI, Cepko CL. J Clin Invest. 2015 Apr;125(4):1433-45. doi: 10.1172/JCI79735. Epub 2015 Mar 23. 10.1172/JCI79735 PubMed 25798616