Skip to main content

Kohinoor-Vimentin/pcDNA3
(Plasmid #67772)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 67772 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Invitrogen
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Kohinoor-Vimentin
  • Species
    Synthetic
  • Promoter CMV
  • Tag / Fusion Protein
    • Vimentin (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer GAAATTAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Kohinoor-Vimentin/pcDNA3 was a gift from Takeharu Nagai (Addgene plasmid # 67772 ; http://n2t.net/addgene:67772 ; RRID:Addgene_67772)
  • For your References section:

    A fast- and positively photoswitchable fluorescent protein for ultralow-laser-power RESOLFT nanoscopy. Tiwari DK, Arai Y, Yamanaka M, Matsuda T, Agetsuma M, Nakano M, Fujita K, Nagai T. Nat Methods. 2015 Jun;12(6):515-8. doi: 10.1038/nmeth.3362. Epub 2015 Apr 20. 10.1038/nmeth.3362 PubMed 25894946