Skip to main content

pSG5-FLAG-mEKLF
(Plasmid #67833)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 67833 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSG5
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4076
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    EKLF
  • Species
    M. musculus (mouse)
  • Mutation
    Full-length mEKLF is aa 20-376; amino acid 19 is the initiator Methionine; See depositor comments below on mutations G299S, T305S
  • Entrez Gene
    Klf1 (a.k.a. Eklf, Nan)
  • Promoter SV40
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site StuI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer SV40pro-F2 (CCCCATGGCTGACTAATTTTT)
  • 3′ sequencing primer SV40 poly A Reverse
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Entire EKLF open reading frame is defined as nucleotides 71-1215 and described in PMID 7682653. Mutations G299S and T305S have no functional consequences.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSG5-FLAG-mEKLF was a gift from James Bieker (Addgene plasmid # 67833 ; http://n2t.net/addgene:67833 ; RRID:Addgene_67833)
  • For your References section:

    Transcription factor EKLF (KLF1) recruitment of the histone chaperone HIRA is essential for beta-globin gene expression. Soni S, Pchelintsev N, Adams PD, Bieker JJ. Proc Natl Acad Sci U S A. 2014 Sep 16;111(37):13337-42. doi: 10.1073/pnas.1405422111. Epub 2014 Sep 2. 10.1073/pnas.1405422111 PubMed 25197097