pSG5-FLAG-mEKLF
(Plasmid
#67833)
-
PurposeExpression of FL-EKLF driven by SV40 promoter
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67833 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSG5
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4076
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEKLF
-
SpeciesM. musculus (mouse)
-
MutationFull-length mEKLF is aa 20-376; amino acid 19 is the initiator Methionine; See depositor comments below on mutations G299S, T305S
-
Entrez GeneKlf1 (a.k.a. Eklf, Nan)
- Promoter SV40
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site StuI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer SV40pro-F2 (CCCCATGGCTGACTAATTTTT)
- 3′ sequencing primer SV40 poly A Reverse (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Entire EKLF open reading frame is defined as nucleotides 71-1215 and described in PMID 7682653. Mutations G299S and T305S have no functional consequences.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSG5-FLAG-mEKLF was a gift from James Bieker (Addgene plasmid # 67833 ; http://n2t.net/addgene:67833 ; RRID:Addgene_67833) -
For your References section:
Transcription factor EKLF (KLF1) recruitment of the histone chaperone HIRA is essential for beta-globin gene expression. Soni S, Pchelintsev N, Adams PD, Bieker JJ. Proc Natl Acad Sci U S A. 2014 Sep 16;111(37):13337-42. doi: 10.1073/pnas.1405422111. Epub 2014 Sep 2. 10.1073/pnas.1405422111 PubMed 25197097