pGEX-2TK-GST-mEKLF
(Plasmid
#67836)
-
PurposeEncodes GST fusion to murine EKLF (nucleotides 71-1215)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67836 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGEX-2TK
-
Backbone manufacturerGE Healthcare Life Sciences
- Backbone size w/o insert (bp) 4969
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEKLF
-
SpeciesM. musculus (mouse)
-
MutationFull-length mEKLF is aa 20-376; amino acid 19 is the initiator Methionine; See depositor comments below on mutations G299S, T305S
-
Entrez GeneKlf1 (a.k.a. Eklf, Nan)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer pGEX5
- 3′ sequencing primer AmpR (ATAATACCGCGCCACATAGC) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Mutations G299S, and T305S have no functional consequences.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX-2TK-GST-mEKLF was a gift from James Bieker (Addgene plasmid # 67836 ; http://n2t.net/addgene:67836 ; RRID:Addgene_67836) -
For your References section:
Acetylation and modulation of erythroid Kruppel-like factor (EKLF) activity by interaction with histone acetyltransferases. Zhang W, Bieker JJ. Proc Natl Acad Sci U S A. 1998 Aug 18;95(17):9855-60. PubMed 9707565