AAV-actin prom-dsRed-scramble shRNA
(Plasmid
#67879)
-
PurposeAAV vector to express dsRed sh RNA (scramble)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 67879 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepUC
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 7200
-
Vector typeMammalian Expression, AAV, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameactin prom-dsRed-scramble shRNA
-
SpeciesG. gallus (chicken), Synthetic
-
Insert Size (bp)3115
- Promoter chicken beta actin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SbfI (unknown if destroyed)
- 3′ cloning site PacI (unknown if destroyed)
- 5′ sequencing primer CTGGCGGTGACCGGCGGCTCTAG
- 3′ sequencing primer GACCCGGCAGCAGGCCG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTo make this plasmid we started with plasmid pPRIME-cmv-dsRed-FF3 (Addgene Plasmid 11664; gift from S. Elledge, Howard Hughes Medical Institute)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
To express shRNAs, we used the pPRIME system. This generates
micro-RNA-30 (mir30)-derived shRNAs and co-expression of a marker protein, such as dsRED, from the same transcript. The shRNA hairpin sequences were placed into the mir30 site of pPRIME-cmv-dsRed-FF3 and then cloned into the AAV vector (Zhang et al 2015 Nat Neurosci),
SbfI(or PstI) + PacI will retrieve the 2.1kb insert (dsRed-scramble shRNA-chloramphenicol) and the 5.1kb AAV-CBA backbone, which is ampicillin resistant. The SbfI site in the middle of dsRed has been silenced. The construct can be linearised with XhoI.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-actin prom-dsRed-scramble shRNA was a gift from William Wisden (Addgene plasmid # 67879 ; http://n2t.net/addgene:67879 ; RRID:Addgene_67879) -
For your References section:
Neuronal ensembles sufficient for recovery sleep and the sedative actions of alpha2 adrenergic agonists. Zhang Z, Ferretti V, Guntan I, Moro A, Steinberg EA, Ye Z, Zecharia AY, Yu X, Vyssotski AL, Brickley SG, Yustos R, Pillidge ZE, Harding EC, Wisden W, Franks NP. Nat Neurosci. 2015 Apr;18(4):553-61. doi: 10.1038/nn.3957. Epub 2015 Feb 23. 10.1038/nn.3957 PubMed 25706476
Map uploaded by the depositor.