pHO4d-Cas9
(Plasmid #67881)

• Purpose: Cas9nlsHis6 Bacterial Expression construct
• Depositing Lab: Michael Nonet
• Publication: Fu et al Nucleic Acids Res. 2014 Dec 16;42(22):13778-87. doi: 10.1093/nar/gku1102. Epub 2014 Nov 15.

Backbone

• Vector backbone: pHO4D
• Backbone size w/o insert (bp): 5712
• Total vector size (bp): 9841
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cas9
• Species: Streptococcus pyrogenes M1
• Insert Size (bp): 4152
• GenBank ID: bp 854751 to 858854 of AE004092.2
• Promoter: T7
• Tags / Fusion Proteins:
  • His6 (C terminal on insert)
  • T7 epitope (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: GCGTAGAGGATCGAGATC
• 3′ sequencing primer: CTTCCTTTCGGGCTTTGTTAGCAGCCGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The insert was cloned into this his6 expression vector from AddGene plasmid #42251
• Articles Citing this Plasmid:
  • 7 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Transform into an appropriate protein expression E. coli strain like BL21 lambda DE3 to purify Cas9