Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHO4d-Cas9
(Plasmid #67881)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 67881 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHO4D
  • Backbone size w/o insert (bp) 5712
  • Total vector size (bp) 9841
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9
  • Species
    Streptococcus pyrogenes M1
  • Insert Size (bp)
    4152
  • GenBank ID
    bp 854751 to 858854 of AE004092.2
  • Promoter T7
  • Tags / Fusion Proteins
    • His6 (C terminal on insert)
    • T7 epitope (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer GCGTAGAGGATCGAGATC
  • 3′ sequencing primer CTTCCTTTCGGGCTTTGTTAGCAGCCGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The insert was cloned into this his6 expression vector from AddGene plasmid #42251
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Transform into an appropriate protein expression E. coli strain like BL21 lambda DE3 to purify Cas9

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHO4d-Cas9 was a gift from Michael Nonet (Addgene plasmid # 67881 ; http://n2t.net/addgene:67881 ; RRID:Addgene_67881)
  • For your References section:

    Landscape of target:guide homology effects on Cas9-mediated cleavage. Fu BX, Hansen LL, Artiles KL, Nonet ML, Fire AZ. Nucleic Acids Res. 2014 Dec 16;42(22):13778-87. doi: 10.1093/nar/gku1102. Epub 2014 Nov 15. 10.1093/nar/gku1102 PubMed 25399416