pC4-RhE-FRB-Fis1
(Plasmid #68056)

• Purpose: express Fis1 tail-anchored FRB for heterodimerization with FKBP in mammalian cells
• Depositing Lab: Richard Youle
• Publication: Narendra et al Autophagy. 2010 Nov;6(8):1090-106.

Backbone

• Vector backbone: pC4-RhE (now pHet-1)
• Backbone manufacturer: ARIAD (now Clontech)
• Backbone size w/o insert (bp): 5329
• Total vector size (bp): 5473
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Fis1
• Species: H. sapiens (human)
• Insert Size (bp): 183
• Mutation: Fis1 tail (aa 93-152)
• Entrez Gene: FIS1 (a.k.a. CGI-135, TTC11)
• Tag / Fusion Protein:
  • FRB (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CMVf: CGC AAA TGG GCG GTA GGC GTG
• 3′ sequencing primer: Bglob-intron-R: TTTGCCCCCTCCATATAACA

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry