Skip to main content

pC4M-F2E-GFP-FKBP
(Plasmid #68058)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 68058 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pC4M-F2E (now pHet-Mem1)
  • Backbone manufacturer
    ARIAD (now Clontech
  • Backbone size w/o insert (bp) 5726
  • Total vector size (bp) 6395
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFP
  • Species
    jellyfish
  • Insert Size (bp)
    717
  • GenBank ID
    U55763.1
  • Promoter CMV
  • Tags / Fusion Proteins
    • 2xFKBP (C terminal on insert)
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CMVf: CGC AAA TGG GCG GTA GGC GTG
  • 3′ sequencing primer Bglob-intron-R: TTTGCCCCCTCCATATAACA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pC4M-F2E-GFP-FKBP was a gift from Richard Youle (Addgene plasmid # 68058 ; http://n2t.net/addgene:68058 ; RRID:Addgene_68058)
  • For your References section:

    p62/SQSTM1 is required for Parkin-induced mitochondrial clustering but not mitophagy; VDAC1 is dispensable for both. Narendra D, Kane LA, Hauser DN, Fearnley IM, Youle RJ. Autophagy. 2010 Nov;6(8):1090-106. 13426 [pii] PubMed 20890124