This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #68058)


Item Catalog # Description Quantity Price (USD)
Plasmid 68058 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    pC4M-F2E (now pHet-Mem1)
  • Backbone manufacturer
    ARIAD (now Clontech
  • Backbone size w/o insert (bp) 5726
  • Total vector size (bp) 6395
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • GenBank ID
  • Promoter CMV
  • Tags / Fusion Proteins
    • 2xFKBP (C terminal on insert)
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CMVf: CGC AAA TGG GCG GTA GGC GTG
  • 3′ sequencing primer Bglob-intron-R: TTTGCCCCCTCCATATAACA
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pC4M-F2E-GFP-FKBP was a gift from Richard Youle (Addgene plasmid # 68058 ; ; RRID:Addgene_68058)
  • For your References section:

    p62/SQSTM1 is required for Parkin-induced mitochondrial clustering but not mitophagy; VDAC1 is dispensable for both. Narendra D, Kane LA, Hauser DN, Fearnley IM, Youle RJ. Autophagy. 2010 Nov;6(8):1090-106. 13426 [pii] PubMed 20890124