Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pICSL80036
(Plasmid #68259)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 68259 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pICH41308 AddGene #47998
  • Total vector size (bp) 3464
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Coding sequence, hygromycin phophotransferase II (Escherichia coli)
  • Alt name
    hptII
  • Species
    E. coli
  • Insert Size (bp)
    1026

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BpiI (destroyed during cloning)
  • 3′ cloning site BpiI (destroyed during cloning)
  • 5′ sequencing primer CGTTATCCCCTGATTCTGTGGATAAC
  • 3′ sequencing primer GTCTCATGAGCGGATACATATTTGAATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pICSL80036 was a gift from Nicola Patron (Addgene plasmid # 68259 ; http://n2t.net/addgene:68259 ; RRID:Addgene_68259)
  • For your References section:

    Induction of targeted, heritable mutations in barley and Brassica oleracea using RNA-guided Cas9 nuclease. Lawrenson T, Shorinola O, Stacey N, Li C, Ostergaard L, Patron N, Uauy C, Harwood W. Genome Biol. 2015 Nov 30;16(1):258. doi: 10.1186/s13059-015-0826-7. 10.1186/s13059-015-0826-7 [pii] PubMed 26616834