Skip to main content
Addgene

pICSL11059
(Plasmid #68263)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 68263 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pICH47732 (AddGene #48000)
  • Total vector size (bp) 7225
  • Vector type
    Plant Expression, Synthetic Biology
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Can also be grown in Agrobacterium tumefaciens strains GV3101 and LBA4404. Will be low copy in this species.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Promoter:35s + 5'UTR:Omega + CDS:hptIIwintron + 3'UTR/terminator:35s
  • Alt name
    35S_hptII_35s
  • Species
    Cauliflower Mosaic Virus, Tobacco Mosaic Virus and Escherichia coli
  • Insert Size (bp)
    2857

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer GAACCCTGTGGTTGGCATGCACATAC
  • 3′ sequencing primer CTGGTGGCAGGATATATTGTGGTG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    This vector was assembled from backbones and parts from from the Golden Gate MoClo Plant Tool Kit (Kit # 1000000044) and The Golden Gate MoClo Plant Parts Kit (Kit # 1000000047).
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pICSL11059 was a gift from Nicola Patron (Addgene plasmid # 68263 ; http://n2t.net/addgene:68263 ; RRID:Addgene_68263)
  • For your References section:

    Induction of targeted, heritable mutations in barley and Brassica oleracea using RNA-guided Cas9 nuclease. Lawrenson T, Shorinola O, Stacey N, Li C, Ostergaard L, Patron N, Uauy C, Harwood W. Genome Biol. 2015 Nov 30;16(1):258. doi: 10.1186/s13059-015-0826-7. 10.1186/s13059-015-0826-7 [pii] PubMed 26616834