-
PurposeLevel 1 Golden Gate Cassette: Plant hygromycin (with intron) resistance cassette
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 68263 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepICH47732 (AddGene #48000)
- Total vector size (bp) 7225
-
Vector typePlant Expression, Synthetic Biology
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsCan also be grown in Agrobacterium tumefaciens strains GV3101 and LBA4404. Will be low copy in this species.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePromoter:35s + 5'UTR:Omega + CDS:hptIIwintron + 3'UTR/terminator:35s
-
Alt name35S_hptII_35s
-
SpeciesCauliflower Mosaic Virus, Tobacco Mosaic Virus and Escherichia coli
-
Insert Size (bp)2857
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer GAACCCTGTGGTTGGCATGCACATAC
- 3′ sequencing primer CTGGTGGCAGGATATATTGTGGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThis vector was assembled from backbones and parts from from the Golden Gate MoClo Plant Tool Kit (Kit # 1000000044) and The Golden Gate MoClo Plant Parts Kit (Kit # 1000000047).
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pICSL11059 was a gift from Nicola Patron (Addgene plasmid # 68263 ; http://n2t.net/addgene:68263 ; RRID:Addgene_68263) -
For your References section:
Induction of targeted, heritable mutations in barley and Brassica oleracea using RNA-guided Cas9 nuclease. Lawrenson T, Shorinola O, Stacey N, Li C, Ostergaard L, Patron N, Uauy C, Harwood W. Genome Biol. 2015 Nov 30;16(1):258. doi: 10.1186/s13059-015-0826-7. 10.1186/s13059-015-0826-7 [pii] PubMed 26616834