PX377 Corynebacter diphtheriae Cas9
(Plasmid
#68314)
-
PurposeCorynebacter diphtheriae Cas9
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 68314 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDREAM
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCdCas9
-
Alt nameCorynebacter diphtheriae Cas9
-
SpeciesSynthetic; Corynebacter diphtheriae
- Promoter CMV
-
Tags
/ Fusion Proteins
- NLS (N terminal on insert)
- NLS (C terminal on insert)
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CMV-F
- 3′ sequencing primer cctagtcagacaaaatgatgcaa
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX377 Corynebacter diphtheriae Cas9 was a gift from Feng Zhang (Addgene plasmid # 68314 ; http://n2t.net/addgene:68314 ; RRID:Addgene_68314)