pmirGLO-Calb2-3'UTR
(Plasmid
#68363)
-
PurposeLuciferase miRNA Target Expression Vector
-
Depositing Labs
-
Depositing OrganizationZurich University Hospital
Located in Switzerland -
Citations
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 68363 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 68363-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 68363-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepmirGLO
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 7350
-
Vector typeMammalian Expression, Luciferase
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCalb2 3'UTR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)571
-
MutationC to T change in UTR
-
GenBank ID794
-
Entrez GeneCALB2 (a.k.a. CAB29, CAL2, CR)
-
Tag
/ Fusion Protein
- luciferase (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer Fluc-F1 AGAAGCTGCGCGGTGGTGTTGTG
- 3′ sequencing primer EBV reverse
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 68363-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 68363-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmirGLO-Calb2-3'UTR was a gift from Emanuela Felley-Bosco & Rolf Stahel (Addgene plasmid # 68363 ; http://n2t.net/addgene:68363 ; RRID:Addgene_68363) -
For your References section:
Posttranscriptional Regulation Controls Calretinin Expression in Malignant Pleural Mesothelioma. Kresoja-Rakic J, Sulemani M, Kirschner MB, Ronner M, Reid G, Kao S, Schwaller B, Weder W, Stahel RA, Felley-Bosco E. Front Genet. 2017 May 29;8:70. doi: 10.3389/fgene.2017.00070. eCollection 2017. 10.3389/fgene.2017.00070 PubMed 28611824