Skip to main content

pmirGLO-Calb2-3'UTR
(Plasmid #68363)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 68363 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 68363-D50 50 μg of DNA in Tris buffer $495
DNA 68363-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pmirGLO
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 7350
  • Vector type
    Mammalian Expression, Luciferase
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Calb2 3'UTR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    571
  • Mutation
    C to T change in UTR
  • GenBank ID
    794
  • Entrez Gene
    CALB2 (a.k.a. CAB29, CAL2, CR)
  • Tag / Fusion Protein
    • luciferase (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer Fluc-F1 AGAAGCTGCGCGGTGGTGTTGTG
  • 3′ sequencing primer EBV reverse
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmirGLO-Calb2-3'UTR was a gift from Emanuela Felley-Bosco & Rolf Stahel (Addgene plasmid # 68363 ; http://n2t.net/addgene:68363 ; RRID:Addgene_68363)
  • For your References section:

    Posttranscriptional Regulation Controls Calretinin Expression in Malignant Pleural Mesothelioma. Kresoja-Rakic J, Sulemani M, Kirschner MB, Ronner M, Reid G, Kao S, Schwaller B, Weder W, Stahel RA, Felley-Bosco E. Front Genet. 2017 May 29;8:70. doi: 10.3389/fgene.2017.00070. eCollection 2017. 10.3389/fgene.2017.00070 PubMed 28611824