pCMV-TNT-CFP-STIM1-C227W
(Plasmid
#68403)
-
PurposeExpresses a STIM1 gain-of-function mutant in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 68403 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMVTnT™ Vector
- Backbone size w/o insert (bp) 4050
- Total vector size (bp) 4400
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCFP-STIM1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2781
-
MutationChanged Cysteine 227 to Tryptophan; CFP was inserted into STIM between G37 and A38.
-
Entrez GeneSTIM1 (a.k.a. D11S4896E, GOK, IMD10, STRMK, TAM, TAM1)
- Promoter CMV
-
Tag
/ Fusion Protein
- Cyan Fluorescent Protein (CFP)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcorI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer ccg GAATTC ATGGATGTATGCGTC CGTCTTG
- 3′ sequencing primer cgg GCGGCCGC CTACTTCTTAAGAGGCTTCTTAAAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-TNT-CFP-STIM1-C227W was a gift from Yubin Zhou (Addgene plasmid # 68403 ; http://n2t.net/addgene:68403 ; RRID:Addgene_68403) -
For your References section:
Inside-out Ca(2+) signalling prompted by STIM1 conformational switch. Ma G, Wei M, He L, Liu C, Wu B, Zhang SL, Jing J, Liang X, Senes A, Tan P, Li S, Sun A, Bi Y, Zhong L, Si H, Shen Y, Li M, Lee MS, Zhou W, Wang J, Wang Y, Zhou Y. Nat Commun. 2015 Jul 17;6:7826. doi: 10.1038/ncomms8826. 10.1038/ncomms8826 PubMed 26184105