Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pCMV-TNT-CFP-STIM1-C227W
(Plasmid #68403)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 68403 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCMVTnT™ Vector
  • Backbone size w/o insert (bp) 4050
  • Total vector size (bp) 4400
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CFP-STIM1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2781
  • Mutation
    Changed Cysteine 227 to Tryptophan; CFP was inserted into STIM between G37 and A38.
  • Promoter CMV
  • Tag / Fusion Protein
    • Cyan Fluorescent Protein (CFP)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcorI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer ccg GAATTC ATGGATGTATGCGTC CGTCTTG
  • 3′ sequencing primer cgg GCGGCCGC CTACTTCTTAAGAGGCTTCTTAAAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-TNT-CFP-STIM1-C227W was a gift from Yubin Zhou (Addgene plasmid # 68403 ; http://n2t.net/addgene:68403 ; RRID:Addgene_68403)
  • For your References section:

    Inside-out Ca(2+) signalling prompted by STIM1 conformational switch. Ma G, Wei M, He L, Liu C, Wu B, Zhang SL, Jing J, Liang X, Senes A, Tan P, Li S, Sun A, Bi Y, Zhong L, Si H, Shen Y, Li M, Lee MS, Zhou W, Wang J, Wang Y, Zhou Y. Nat Commun. 2015 Jul 17;6:7826. doi: 10.1038/ncomms8826. 10.1038/ncomms8826 PubMed 26184105