pTrans_9xD3B_Cluc_Norm
(Plasmid
#68415)
-
PurposeCRISPR-Display Cypridina Luciferase-2A-Venus YFP "normalizer," transient format.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 68415 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepNEB193
-
Backbone manufacturerNEB
-
Vector typeMammalian Expression, Luciferase
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCypridina Luciferase-2A-Venus YFP
-
MutationYFP: M153T,V163A,S175G ("Venus") YFP Variant
- Promoter minimalCMV
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer LNCX
- 3′ sequencing primer EGFP-N
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Reporters are separated by 2A "self-cleaving" peptides. The reporter cassette is under the control of a minimal CMV promoter, preceeded by a casette of nine (ATCTAGATCGCCCGTCCCCT)AGG sites
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTrans_9xD3B_Cluc_Norm was a gift from John Rinn (Addgene plasmid # 68415 ; http://n2t.net/addgene:68415 ; RRID:Addgene_68415) -
For your References section:
Multiplexable, locus-specific targeting of long RNAs with CRISPR-Display. Shechner DM, Hacisuleyman E, Younger ST, Rinn JL. Nat Methods. 2015 Jul;12(7):664-70. doi: 10.1038/nmeth.3433. Epub 2015 Jun 1. 10.1038/nmeth.3433 PubMed 26030444