Skip to main content
Addgene
Open Menu

PAX6 sgRNA7
(Plasmid #68466)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 68466 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 68466-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 68466-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    Cas9 sgRNA vevctor
  • Backbone manufacturer
    Su-Chun Zhang (Addgene plasmid# 68463)
  • Backbone size w/o insert (bp) 3952
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting PAX6
  • gRNA/shRNA sequence
    gatactggagaagcaggggc
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_000280.4
  • Entrez Gene
    PAX6 (a.k.a. AN, AN1, AN2, ASGD5, D11S812E, FVH1, MGDA, WAGR)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer T7
  • 3′ sequencing primer SP6
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PAX6 sgRNA7 was a gift from Su-Chun Zhang (Addgene plasmid # 68466 ; http://n2t.net/addgene:68466 ; RRID:Addgene_68466)

  • For your References section:

    Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9. Chen Y, Cao J, Xiong M, Petersen AJ, Dong Y, Tao Y, Huang CT, Du Z, Zhang SC. Cell Stem Cell. 2015 Jul 1. pii: S1934-5909(15)00261-1. doi: 10.1016/j.stem.2015.06.001. 10.1016/j.stem.2015.06.001 PubMed 26145478
Related items:
Commonly requested with: