pTRE:shRNA B-pGK:rtTA-Cre
(Plasmid
#68473)
-
PurposeInducible lentivirus expressing an arbitrary shRNA and Cre
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 68473 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLV 1-5
- Backbone size w/o insert (bp) 5818
- Total vector size (bp) 10158
-
Vector typeMammalian Expression, Lentiviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameGFP-shRNA A-miR30
-
Insert Size (bp)1534
- Promoter pTRE
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GATCAGTGTGAGGGAGTGTAAAGCTGGTTT
- 3′ sequencing primer AGGCCTCGGGATTCCTAGGAACAGCGGTTT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namertTA-2A-Cre
-
Insert Size (bp)1851
- Promoter pGK
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer AAACCGCTGTTCCTAGGAATCCCGAGGCCT
- 3′ sequencing primer AGAGTAATTCAACCCCAAACAACAACGTTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRE:shRNA B-pGK:rtTA-Cre was a gift from Tyler Jacks (Addgene plasmid # 68473) -
For your References section:
A Modular Assembly Platform for Rapid Generation of DNA Constructs. Akama-Garren EH, Joshi NS, Tammela T, Chang GP, Wagner BL, Lee DY, Rideout Iii WM, Papagiannakopoulos T, Xue W, Jacks T. Sci Rep. 2016 Feb 18;6:16836. doi: 10.1038/srep16836. 10.1038/srep16836 PubMed 26887506