-
PurposeAAV expression of Cre-GFP fusion
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 68544 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-MCS
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4650
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCre
-
Alt nameCre recombinase
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer pCAX-F CAGCTCCTGGGCAACGTGC
- 3′ sequencing primer hGH-PA-R CCAGCTTGGTTCCCAATAGA (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-Cre-GFP was a gift from Eric Nestler (Addgene plasmid # 68544 ; http://n2t.net/addgene:68544 ; RRID:Addgene_68544) -
For your References section:
Class I HDAC inhibition blocks cocaine-induced plasticity by targeted changes in histone methylation. Kennedy PJ, Feng J, Robison AJ, Maze I, Badimon A, Mouzon E, Chaudhury D, Damez-Werno DM, Haggarty SJ, Han MH, Bassel-Duby R, Olson EN, Nestler EJ. Nat Neurosci. 2013 Apr;16(4):434-40. doi: 10.1038/nn.3354. Epub 2013 Mar 10. 10.1038/nn.3354 PubMed 23475113