Skip to main content
Addgene

myc-hRAD18 dSAP
(Plasmid #68830)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 68830 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAGGS
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    c-myc tagged human RAD18 deleting SAP domain
  • Alt name
    myc hRAD18 dSAP
  • Species
    H. sapiens (human)
  • Entrez Gene
    RAD18 (a.k.a. RNF73)
  • Promoter CAG
  • Tag / Fusion Protein
    • c-myc

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer GCTTCTGGCGTGTGACC
  • 3′ sequencing primer GTATTTGTGAGCCAGGGCAT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    myc-hRAD18 dSAP was a gift from Satoshi Tateishi (Addgene plasmid # 68830 ; http://n2t.net/addgene:68830 ; RRID:Addgene_68830)
  • For your References section:

    RAD18 promotes DNA double-strand break repair during G1 phase through chromatin retention of 53BP1. Watanabe K, Iwabuchi K, Sun J, Tsuji Y, Tani T, Tokunaga K, Date T, Hashimoto M, Yamaizumi M, Tateishi S. Nucleic Acids Res. 2009 Apr;37(7):2176-93. doi: 10.1093/nar/gkp082. Epub 2009 Feb 19. 10.1093/nar/gkp082 PubMed 19228710