Skip to main content

Cx30-msfGFP
(Plasmid #69019)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69019 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    EGFP-N1
  • Total vector size (bp) 5350
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    JM109
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cx30
  • Species
    H. sapiens (human)
  • Entrez Gene
    GJB6 (a.k.a. CX30, DFNA3, DFNA3B, DFNB1B, ECTD2, ED2, EDH, HED, HED2)
  • Promoter c
  • Tag / Fusion Protein
    • V206K monomerized super folder GFP (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer EGFP-N: CGTCGCCGTCCAGCTCGACCAG
  • 3′ sequencing primer C1N1-rev: ACCTCTACAAATGTGGTATGGCTGATTATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Cx30-msfGFP was a gift from David Spray (Addgene plasmid # 69019 ; http://n2t.net/addgene:69019 ; RRID:Addgene_69019)
  • For your References section:

    Connexin Type and Fluorescent Protein-fusion Tag Determine Structural Stability of Gap Junction Plaques. Stout RF Jr, Snapp EL, Spray DC. J Biol Chem. 2015 Aug 11. pii: jbc.M115.659979. 10.1074/jbc.M115.659979 PubMed 26265468