Skip to main content

EBFP2-Cx43
(Plasmid #69020)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69020 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    EGFP-C1
  • Total vector size (bp) 5888
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    JM109
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cx43
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1146
  • Entrez Gene
    Gja1 (a.k.a. Cx43, Cxnk1)
  • Promoter CMV
  • Tag / Fusion Protein
    • EBFP2 (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CMV
  • 3′ sequencing primer C1N1-rev: ACCTCTACAAATGTGGTATGGCTGATTATG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note all connexins tested that have a fluorescent protein fused to the connexin amino-terminus do not form functional channels. This plasmid forms gap junction plaque structures but does not produce intercellular coupling.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EBFP2-Cx43 was a gift from David Spray (Addgene plasmid # 69020 ; http://n2t.net/addgene:69020 ; RRID:Addgene_69020)
  • For your References section:

    Connexin Type and Fluorescent Protein-fusion Tag Determine Structural Stability of Gap Junction Plaques. Stout RF Jr, Snapp EL, Spray DC. J Biol Chem. 2015 Aug 11. pii: jbc.M115.659979. 10.1074/jbc.M115.659979 PubMed 26265468