pES003 (pTet-qacR 2)
(Plasmid
#69032)
-
PurposeqacR 2 downstream of a Tet promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 69032 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep15A Ori/cm resistant
-
Backbone manufacturerunknown
- Backbone size w/o insert (bp) 1154
- Total vector size (bp) 3117
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameqacR
-
SpeciesSynthetic
-
Insert Size (bp)596
-
MutationE57Q, E58L, W61Y, E90Q, I99Q, M116Q, L119Y, E120Q, N154M, N157L, T161M
-
Entrez GeneqacR (a.k.a. pTZ2162_28)
- Promoter pTet
-
Tag
/ Fusion Protein
- His6 tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer GCTTATCATCGATAAGCTTCC
- 3′ sequencing primer CGCCCGGTAGTGATCTTAT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pES003 (pTet-qacR 2) was a gift from Richard Murray (Addgene plasmid # 69032 ; http://n2t.net/addgene:69032 ; RRID:Addgene_69032) -
For your References section:
Engineering Transcriptional Regulator Effector Specificity Using Computational Design and In Vitro Rapid Prototyping: Developing a Vanillin Sensor. de Los Santos EL, Meyerowitz JT, Mayo SL, Murray RM. ACS Synth Biol. 2015 Aug 19. 10.1021/acssynbio.5b00090 PubMed 26262913