pJBL-RNAINS3
(Plasmid #69455)

• Purpose: RNA-IN S3 variant 5' UTR sequence controlling expression of superfolder GFP (UTR sequence from Mutalik et al., Nat. Chem. Biol., 2012)
• Depositing Lab: Julius Lucks
• Publication: Watters et al Nucleic Acids Res. 2015 Sep 8. pii: gkv879.

Backbone

• Vector backbone: custom
• Backbone manufacturer: N/A
• Backbone size w/o insert (bp): 2200
• Total vector size (bp): 3100
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: RNA-IN S3
• Alt name: IS10 (mutated S3 variant)
• Species: Synthetic
• Insert Size (bp): 900
• Mutation: mutations for S3 variant (from wt)
• Promoter: J23119

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: aaatgtagcacctgaagtcagcccc

Resource Information

• Supplemental Documents:
  • RNA-IN S3 .ape file

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Mutated from sequence obtained from Arkin Lab (UC Berkeley)