-
PurposeExpresses AMPK alpha1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69504 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepECE
- Backbone size w/o insert (bp) 2900
- Total vector size (bp) 4589
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name5'-AMP-activated protein kinase catalytic subunit alpha-1
-
Alt namePRKAA1
-
Alt nameAMPK1
-
SpeciesH. sapiens (human)
-
GenBank IDBC037303
-
Entrez GenePRKAA1 (a.k.a. AMPK, AMPK alpha 1, AMPKa1)
- Promoter SV40 early promoter
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CATTCTCCGCCCCATGGCTGAC
- 3′ sequencing primer GTTTCAGGTTCAGGGGGAGGTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycDNA is from the Orfeome library (Open Biosystems)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pECE HA AMPKa1 WT was a gift from Anne Brunet (Addgene plasmid # 69504 ; http://n2t.net/addgene:69504 ; RRID:Addgene_69504) -
For your References section:
Identification of AMPK Phosphorylation Sites Reveals a Network of Proteins Involved in Cell Invasion and Facilitates Large-Scale Substrate Prediction. Schaffer BE, Levin RS, Hertz NT, Maures TJ, Schoof ML, Hollstein PE, Benayoun BA, Banko MR, Shaw RJ, Shokat KM, Brunet A. Cell Metab. 2015 Nov 3;22(5):907-21. doi: 10.1016/j.cmet.2015.09.009. Epub 2015 Oct 8. 10.1016/j.cmet.2015.09.009 PubMed 26456332