Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pECE HA AMPKa1 WT
(Plasmid #69504)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 69504 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pECE
  • Backbone size w/o insert (bp) 2900
  • Total vector size (bp) 4589
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    5'-AMP-activated protein kinase catalytic subunit alpha-1
  • Alt name
    PRKAA1
  • Alt name
    AMPK1
  • Species
    H. sapiens (human)
  • GenBank ID
    BC037303
  • Entrez Gene
    PRKAA1 (a.k.a. AMPK, AMPK alpha 1, AMPKa1)
  • Promoter SV40 early promoter
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CATTCTCCGCCCCATGGCTGAC
  • 3′ sequencing primer GTTTCAGGTTCAGGGGGAGGTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    cDNA is from the Orfeome library (Open Biosystems)
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pECE HA AMPKa1 WT was a gift from Anne Brunet (Addgene plasmid # 69504 ; http://n2t.net/addgene:69504 ; RRID:Addgene_69504)