pBS-L1PA1CH blast
(Plasmid
#69612)
-
PurposeExpresses a blasticidin tagged codon optimized L1PA1
-
Depositing Lab
-
Depositing OrganizationTulane University
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 69612 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 69612-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 69612-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepBluescript
- Backbone size w/o insert (bp) 3530
- Total vector size (bp) 10811
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin ; detects retrotransposition not the plasmid
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsAny standard E.coli strain should work fine
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameL1PA1
-
Alt nameLINE-1 PA1 subfamily
-
Alt nameL1HS
-
Alt nameL1RP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)7658
- Promoter CMV
-
Tag
/ Fusion Protein
- blast cassette
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AGGCGTGTACGGTGGGAGGTCTA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 69612-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 69612-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBS-L1PA1CH blast was a gift from Astrid Roy-Engel (Addgene plasmid # 69612 ; http://n2t.net/addgene:69612 ; RRID:Addgene_69612)